View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6355_low_32 (Length: 251)
Name: NF6355_low_32
Description: NF6355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6355_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 246
Target Start/End: Complemental strand, 20533535 - 20533310
Alignment:
| Q |
20 |
ctttagaagttaatcggagccggatcacagtagaaataagtcatatgcaagtcttttcccttgaatttgaaaaatagagtaaaaaagggctttaataaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20533535 |
ctttagaagttaatcggagccggatcacagtagaaataagtcatatgcaagtcttttcccttgaatttgaaaaatagagtaaaaaagggctttaataaca |
20533436 |
T |
|
| Q |
120 |
gtttgtcaattcgactcgccccccataaagatctcttgtatctctttaggatggatgcagctagaactttatatactatagagtagtctctttcgaattt |
219 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20533435 |
gtttgtcaattcgactcgccccccagaaagatctcttgtatctctttaagatggatgcagctagaactttatatactatagagtagtctctttcgaattt |
20533336 |
T |
|
| Q |
220 |
tttccttttgttttcctctctggtgct |
246 |
Q |
| |
|
||||||||| |||||||| ||| |||| |
|
|
| T |
20533335 |
tttcctttt-ttttcctccctgttgct |
20533310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University