View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6355_low_33 (Length: 245)

Name: NF6355_low_33
Description: NF6355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6355_low_33
NF6355_low_33
[»] chr4 (1 HSPs)
chr4 (18-236)||(35213312-35213530)


Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 35213530 - 35213312
Alignment:
18 gagaaatgtgttaaaaatgaaggttgagtcagttggaaacccttaaaaaattgccaaatgccaactacatttatggcaaacaaaataatgaggaaacaat 117  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35213530 gagaaatgtgtaaaaaatgaaggttgagtcagttggaaacccttaaaaaattgccaaatgccaactacatttatggcaaacaaaataatgaggaaacaat 35213431  T
118 caaatcttcaccatcagagattgacaagatgagaaatcactttcagaaaatgacaacaagatgagtaagaccacccttgcccaatctgagtactacgaca 217  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||    
35213430 caaatcttcatcatcagagattgacaagatgagaaatcactttcagaaaatgacaacaagatgagtaagaccacccttgcccaatccgagtactaagaca 35213331  T
218 gtaaaacttggtgcatctc 236  Q
    |||||||||||||||||||    
35213330 gtaaaacttggtgcatctc 35213312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University