View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6355_low_36 (Length: 239)
Name: NF6355_low_36
Description: NF6355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6355_low_36 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 33025240 - 33025476
Alignment:
| Q |
18 |
aattacaaagagaagaaggagcacgaagcacaacaatatgaagagcataatc--gagtgtggaatca----tcgttgatgtcattttcatctattcgtgt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
33025240 |
aattacaaagagaagaaggagcacgaagcacaacaatatgaagagcataattaagagtgaggaatcaatcatctttgatgtcattttcatctattcgtgt |
33025339 |
T |
 |
| Q |
112 |
aaatctaccacgagtatgagtagctaaatt---------tggtgggatcagatgtagttaattatgaatcttttgtataacttttgatctcatgattata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33025340 |
aaatctaccacgagtatgagtagctaaattcttatttgttggtgggatcatttgtagttaattatgaatcttttgtataacttttgatctcatgattata |
33025439 |
T |
 |
| Q |
203 |
caagttcttgttattcatgatatcgatgttttcttct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33025440 |
caagttcttgttattcatgatatcgatgttttattct |
33025476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University