View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6355_low_40 (Length: 227)
Name: NF6355_low_40
Description: NF6355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6355_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 7 - 122
Target Start/End: Complemental strand, 35213908 - 35213793
Alignment:
| Q |
7 |
gaaattggttcataatctgcaggagtatcccacattaattgttgattgaacgataaacttgagctctacttcaaagatatgaaatccatgggaggtagcg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35213908 |
gaaattggttcataatctgcaggagtatcccacattaattgttgattgaacgataaacttgagctctacttcaaagatatgaaatccatgggaggtagcg |
35213809 |
T |
 |
| Q |
107 |
gaaacataacacatag |
122 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35213808 |
gaaacataacacatag |
35213793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 123 - 227
Target Start/End: Complemental strand, 35213735 - 35213631
Alignment:
| Q |
123 |
ccacaaatgtgaagagtggttttgtgatcttaaacatgctgtatataagaggtaggccaaatgttaaattatgttgatgcataaggaccaaagaagttga |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35213735 |
ccacaaatgtgaagagtggttttgtgatcttaaacatgctgtatataagaggtaggccaaatgttaaattatgttgatgcataaggaccaaagaagttga |
35213636 |
T |
 |
| Q |
223 |
atgta |
227 |
Q |
| |
|
||||| |
|
|
| T |
35213635 |
atgta |
35213631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University