View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6355_low_41 (Length: 221)

Name: NF6355_low_41
Description: NF6355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6355_low_41
NF6355_low_41
[»] chr4 (1 HSPs)
chr4 (19-203)||(33552338-33552522)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 203
Target Start/End: Complemental strand, 33552522 - 33552338
Alignment:
19 aatatcaattgaattataaatgaatcataaaaatcatcataattagaagccaacattattacacaaaagaccgccatatccatctcttgttttaacatat 118  Q
    ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||    
33552522 aatatcaattgaattatgaatgaatcataaaaatcctcataattagaagccaacattattacacaaaagaccgccatatccatctcttgtttaaatatat 33552423  T
119 tatgtttcgatgacgtcaagcataccaaattgttgcaacaaagatgaaggaatgaaagcttttggttcaaacaataagagtaaat 203  Q
    ||||| | |||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33552422 tatgtcttgatgacgtcaagcccaccaaattgttgcaacaaagatgaaggaatgaaagcttttggttcaaacaataagagtaaat 33552338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University