View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6356_high_4 (Length: 255)

Name: NF6356_high_4
Description: NF6356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6356_high_4
NF6356_high_4
[»] scaffold0023 (1 HSPs)
scaffold0023 (1-174)||(88894-89067)
[»] scaffold0001 (1 HSPs)
scaffold0001 (1-97)||(149251-149347)
[»] chr7 (1 HSPs)
chr7 (1-96)||(5468534-5468629)
[»] chr5 (8 HSPs)
chr5 (3-98)||(33763706-33763801)
chr5 (1-104)||(33736430-33736533)
chr5 (1-99)||(33823141-33823239)
chr5 (1-98)||(33698918-33699015)
chr5 (1-101)||(33867301-33867401)
chr5 (1-99)||(33904847-33904945)
chr5 (46-99)||(33750175-33750228)
chr5 (1-97)||(33680385-33680481)
[»] chr8 (1 HSPs)
chr8 (32-86)||(21306326-21306380)
[»] scaffold0247 (1 HSPs)
scaffold0247 (1-138)||(19855-19991)
[»] scaffold0193 (1 HSPs)
scaffold0193 (1-138)||(23303-23439)


Alignment Details
Target: scaffold0023 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: scaffold0023
Description:

Target: scaffold0023; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 88894 - 89067
Alignment:
1 aaaggtgcctggacgtatgaagaagataacttactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggtatat 100  Q
    |||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||| ||||||||||||||    
88894 aaaggtacctggacgaatgaagaagataacttactcaaggcatgcattaacaagtatggtcaaggaaaatggcatctagttcctcgaagagcaggtatat 88993  T
101 atgaatcatgcttattcttctaggtatttggcgtataactattaaaactaaacgaccaattataaaagcttttc 174  Q
    | ||||||||||||||||  || ||||||||| |||||||||| ||||| ||| | ||| ||||||||||||||    
88994 acgaatcatgcttattctattatgtatttggcatataactattcaaactgaacaaacaactataaaagcttttc 89067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 149347 - 149251
Alignment:
1 aaaggtgcctggacgtatgaagaagataacttactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggta 97  Q
    |||||||||||||| || || ||||||||  |||||||||| |||||| ||||||| || |||||||||||||||||||||||||||||||||||||    
149347 aaaggtgcctggacatacgaggaagataagctactcaaggcttgcattgacaagtatggggaaggaaaatggcatttagttcctcaaagagcaggta 149251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 5468534 - 5468629
Alignment:
1 aaaggtgcctggacgtatgaagaagataacttactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggt 96  Q
    |||||||| ||||| || || ||||| |||||||||||||| | |||||||||||| ||||||||||||||||||||| |||||||||||||||||    
5468534 aaaggtgcatggacatacgaggaagacaacttactcaaggcttacattaacaagtatggtgaaggaaaatggcatttaattcctcaaagagcaggt 5468629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 8)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 3 - 98
Target Start/End: Complemental strand, 33763801 - 33763706
Alignment:
3 aggtgcctggacgtatgaagaagataacttactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggtat 98  Q
    |||||||||||| ||||| ||||||||  |||||||||| |||||||||||||| |||||||||||||||||||| ||||| || |||||||||||    
33763801 aggtgcctggacatatgaggaagataagctactcaaggcttgcattaacaagtatggtgaaggaaaatggcattttgttccacagagagcaggtat 33763706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 33736533 - 33736430
Alignment:
1 aaaggtgcctggacgtatgaagaagataacttactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggtatat 100  Q
    |||||||| ||||| ||||| ||||| ||  |||||||||| || ||  | ||||| |||||||||||||||||||||||| ||||||||||||||||||    
33736533 aaaggtgcatggacatatgaggaagacaagctactcaaggcttgtatacagaagtatggtgaaggaaaatggcatttagtttctcaaagagcaggtatat 33736434  T
101 atga 104  Q
    ||||    
33736433 atga 33736430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 33823239 - 33823141
Alignment:
1 aaaggtgcctggacgtatgaagaagataacttactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggtata 99  Q
    |||||||| ||||| ||||| ||||| |||||||||||||| | |||| ||||||| ||||||||||||||||||||| ||||  ||||| ||||||||    
33823239 aaaggtgcatggacatatgaggaagacaacttactcaaggcttacattcacaagtatggtgaaggaaaatggcatttaattcccaaaagaacaggtata 33823141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 33699015 - 33698918
Alignment:
1 aaaggtgcctggacgtatgaagaagataacttactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggtat 98  Q
    |||||||| ||||| ||||| ||||||||  |||||||||| |||||  ||||||| ||||||||||||||||||||||||||| || || |||||||    
33699015 aaaggtgcatggacatatgaggaagataatctactcaaggcttgcatccacaagtatggtgaaggaaaatggcatttagttcctaaacgaacaggtat 33698918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 33867401 - 33867301
Alignment:
1 aaaggtgcctggacgtatgaagaagataacttactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggtatat 100  Q
    |||||||| ||||| ||||| ||||| ||  |||||||||| || ||  | ||||| |||||||||||||||||||||||||| ||||||||||||||||    
33867401 aaaggtgcatggacatatgaggaagacaagctactcaaggcttgtatgcagaagtatggtgaaggaaaatggcatttagttccacaaagagcaggtatat 33867302  T
101 a 101  Q
    |    
33867301 a 33867301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 33904945 - 33904847
Alignment:
1 aaaggtgcctggacgtatgaagaagataacttactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggtata 99  Q
    |||||||| ||||| ||||| ||||| ||  |||||||||| || ||  | ||||| |||||||||||||||||||||||||| |||||||||||||||    
33904945 aaaggtgcatggacatatgaggaagacaagctactcaaggcttgtatacagaagtatggtgaaggaaaatggcatttagttccacaaagagcaggtata 33904847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 46 - 99
Target Start/End: Complemental strand, 33750228 - 33750175
Alignment:
46 attaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggtata 99  Q
    ||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||    
33750228 attaacaagtatggtgaaggaaaatggcatttaattcctaaaagagcaggtata 33750175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 33680481 - 33680385
Alignment:
1 aaaggtgcctggacgtatgaagaagataacttactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggta 97  Q
    |||||||| ||||| ||||| || || ||  |||||||||  || ||| | || || |||||||| |||||||||||||||||| ||||||||||||    
33680481 aaaggtgcatggacatatgaggaggacaatctactcaaggactgtattcaaaaatatggtgaagggaaatggcatttagttcctaaaagagcaggta 33680385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 32 - 86
Target Start/End: Complemental strand, 21306380 - 21306326
Alignment:
32 tactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctca 86  Q
    |||||||||| |||||||||| ||||||||||||||||||| |||||||||||||    
21306380 tactcaaggcttgcattaacacgtacggtgaaggaaaatggaatttagttcctca 21306326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0247 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0247
Description:

Target: scaffold0247; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 19855 - 19991
Alignment:
1 aaaggtgcctggacgtatgaagaagataacttactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggtatat 100  Q
    |||||||| ||||| ||||||||||| ||||  |||||||| | ||||  |||| | |||| |||||||||||||||| ||||| ||||| ||||||||     
19855 aaaggtgcatggacatatgaagaagacaactgtctcaaggcttacattctcaagcatggtgtaggaaaatggcatttaattcctgaaagaacaggtata- 19953  T
101 atgaatcatgcttattcttctaggtatttggcgtataa 138  Q
    | ||||  | |||||||| ||| ||||||||| |||||    
19954 aagaatgttccttattctactacgtatttggcttataa 19991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0193 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0193
Description:

Target: scaffold0193; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 23303 - 23439
Alignment:
1 aaaggtgcctggacgtatgaagaagataacttactcaaggcatgcattaacaagtacggtgaaggaaaatggcatttagttcctcaaagagcaggtatat 100  Q
    |||||||| ||||| ||||||||||| ||||  |||||||| | ||||  |||| | |||| |||||||||||||||| ||||| ||||| ||||||||     
23303 aaaggtgcatggacatatgaagaagacaactgtctcaaggcttacattctcaagcatggtgtaggaaaatggcatttaattcctgaaagaacaggtata- 23401  T
101 atgaatcatgcttattcttctaggtatttggcgtataa 138  Q
    | ||||  | |||||||| ||| ||||||||| |||||    
23402 acgaatgttccttattctactacgtatttggcttataa 23439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University