View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6356_high_6 (Length: 201)
Name: NF6356_high_6
Description: NF6356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6356_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 3363738 - 3363557
Alignment:
| Q |
1 |
cgtgtcggtctatgtggcaattttggtggggctcacatccatggtccaattgagtaaaatttgtaattaaggttgaatttgccgacccaaatgatggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3363738 |
cgtgtcggtctatgtggcaattttggtggggctcacatccatggtccaattgagtaaattttgtaattaaggttgaatttgccgacccaaatgatggttt |
3363639 |
T |
 |
| Q |
101 |
ccacgttacaccaccgcctctatcggttttcccttgtcagtgtcactcactcaatttataaacacatttgtaaaaataaaaa |
182 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3363638 |
ccacgttacaccaccgcctctattggttttcccttgtcagtttcactcactcaatttataaacacatttgtaaaaataaaaa |
3363557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University