View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6357_high_1 (Length: 370)
Name: NF6357_high_1
Description: NF6357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6357_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 287
Target Start/End: Complemental strand, 25296252 - 25295980
Alignment:
| Q |
19 |
cttgagggaaattcccggctgaaattccaacattccccaccattgctatgcatgggatgcatttgccacatttggcaatgcaccgtggtggggaagatca |
118 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296252 |
cttgagggaaatacccgactgaaattccaacattccccaccattgctatgcatgggatgcatttgccacatttggcaatgcaccgtggtggggaagatca |
25296153 |
T |
|
| Q |
119 |
tgggcctgagttggccacaatgcagaagaagatgatgatga----tgaatattgtttagttcctcatagttcagaagtgagttcgcagggagaagtgaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||| |||||||||||| ||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25296152 |
tgggcctgagttggccacaatgcagaagaagaagaagatgatcagtgaatattgtttggttcctcatagctcagaagtgaggtcgcagggagaagtgaca |
25296053 |
T |
|
| Q |
215 |
ctagattaatagtatatgtacattctctactcttctacagcgctcttggtcaaattgtgaactgttatattac |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25296052 |
ctagattaatagtatatgtacattctctactcttctacagcgctcttggtcaaattgtgaactgtcatattac |
25295980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University