View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6357_high_5 (Length: 238)
Name: NF6357_high_5
Description: NF6357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6357_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 31 - 223
Target Start/End: Original strand, 26124450 - 26124637
Alignment:
| Q |
31 |
tgtagcttaatcttttcaatatgatcaaataataacgtttcatataaatagtagtacaaaacatcgtgtccttttacctaatagtaatagttagatttct |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26124450 |
tgtagcttaatcttttcaatatgatcaaataataacgtttgatataaatagt---acaaaacatcgtgtccttttacctaatagtaatagttagatttct |
26124546 |
T |
 |
| Q |
131 |
gttctgataaataccaaatgtctgtgtcgactataattatgaagtagtagttgccacttccagaaatttgtgaacttggtcaattgaaaaatc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26124547 |
gttctgataaataccaaatgtctgtgtcgac--taattatgaagtagtagttgccacttccagaaatttgtgaacttagtcaattgaaaaatc |
26124637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University