View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6357_low_4 (Length: 294)
Name: NF6357_low_4
Description: NF6357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6357_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 15 - 273
Target Start/End: Original strand, 7523875 - 7524134
Alignment:
| Q |
15 |
aaatggtggtggtgaggacggtgatgacagtggtgacgatggatgggagttggatctgtgaagaaggttggtggatggtgctgtgaatgcagatctaagg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7523875 |
aaatggtggtggtgaggacggtgatgacagtggtgacgatggatgggagttgtatctgtgaagaaggttggtggatggtgctgtgaatgcagatctaagg |
7523974 |
T |
|
| Q |
115 |
agagggatgacagtggt-atataaggatagtggtgatggtggtgtacgaagatcgtaaaagaaggctgagatggtgaagcgacgacggtcgccggtggtc |
213 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
7523975 |
agagggatgacagtggtgatataaggatagtggtgatggtggtgaacggagatcataaaagaaggctgagatggtaaagcgacgacggtcgtcggtggtc |
7524074 |
T |
|
| Q |
214 |
agagagatgagtggtggatggttggtgggtgggagatgagagagaaaggaaacaatatgg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7524075 |
agagagatgagtggtggatggttggtgggggggagatgagagagaaaggaaacaatatgg |
7524134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 143 - 264
Target Start/End: Original strand, 7560088 - 7560209
Alignment:
| Q |
143 |
gtggtgatggtggtgtacgaagatcgtaaaagaaggctgagatggtgaagcgacgacggtcgccggtggtcagagagatgagtggtggatggttggtggg |
242 |
Q |
| |
|
||||||||||||||| | | |||||||| ||||||||| |||||||||||||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
7560088 |
gtggtgatggtggtgaatggagatcgtagaagaaggcttagatggtgaagcgacgacggtcatcggtggttagggagatgagtggtggatggttggtggg |
7560187 |
T |
|
| Q |
243 |
tgggagatgagagagaaaggaa |
264 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7560188 |
tgggagatgagagagaaaggaa |
7560209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 264
Target Start/End: Original strand, 963615 - 963679
Alignment:
| Q |
200 |
ggtcgccggtggtcagagagatgagtggtggatggttggtgggtgggagatgagagagaaaggaa |
264 |
Q |
| |
|
|||||||| |||||||| || ||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
963615 |
ggtcgccgatggtcagaaaggggagcggtggatggttggtggctgggagatgagagagaaaggaa |
963679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 963472 - 963547
Alignment:
| Q |
19 |
ggtggtggtgaggacggtgatgacagtggtgacgatggatgggagttggatctgtgaagaaggttggtggatggtg |
94 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||| ||| || ||| ||||| || |||||||||||||| ||||| |
|
|
| T |
963472 |
ggtgctggtgaggacggtgatgacattggtgacggtgggtgagagatggatatgaaaagaaggttggtgggtggtg |
963547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 232 - 267
Target Start/End: Complemental strand, 16464334 - 16464299
Alignment:
| Q |
232 |
tggttggtgggtgggagatgagagagaaaggaaaca |
267 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16464334 |
tggttggagggtgggagatgagagagaaaggaaaca |
16464299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 232 - 270
Target Start/End: Original strand, 16834557 - 16834595
Alignment:
| Q |
232 |
tggttggtgggtgggagatgagagagaaaggaaacaata |
270 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
16834557 |
tggttggagggtgggagatgagagagaaaggaaataata |
16834595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 94
Target Start/End: Complemental strand, 19634563 - 19634490
Alignment:
| Q |
21 |
tggtggtgaggacggtgatgacagtggtgacgatggatgggagttggatctgtgaagaaggttggtggatggtg |
94 |
Q |
| |
|
||||||||||||||||| ||| ||||||| || ||| || ||| |||||| | ||||||||||| ||| ||||| |
|
|
| T |
19634563 |
tggtggtgaggacggtggtgatagtggtggcggtgggtgagagatggatccgagaagaaggttgatgggtggtg |
19634490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University