View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6357_low_9 (Length: 227)
Name: NF6357_low_9
Description: NF6357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6357_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 4 - 219
Target Start/End: Complemental strand, 46055800 - 46055585
Alignment:
| Q |
4 |
tgagggttttataagagcctaaaagtttaaccaaagtagaaagtatctatttctttaagggttagagatcttttacgtgtataacatataatagaagatg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46055800 |
tgagggttttataagagcctaaaagtttaaccaaagtagaaaatatctatttctttaagggttagagatcttttacgtgtataacatataatagaagatg |
46055701 |
T |
 |
| Q |
104 |
gactctaacatagttaatctcttgcgatcaatccaaaataattcacatattatcgtctgatttttattagagagttgtgatttgatctagtatggtgatg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46055700 |
gactctaacatagttaatctcttgcgatcaatccaaaataattcacatattatcgtctgatttttattagagagtcgtgatttgatctagtatggtgatg |
46055601 |
T |
 |
| Q |
204 |
aacacgatgatgtcca |
219 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
46055600 |
aaagcgatgatgtcca |
46055585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University