View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6358_high_11 (Length: 260)
Name: NF6358_high_11
Description: NF6358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6358_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 11 - 245
Target Start/End: Complemental strand, 38006096 - 38005862
Alignment:
| Q |
11 |
catagggcctgatgtagttttaaaatttctcaggtaaaatcagtagaaggttatcttaattactaagagacagattatgcattagcatagattgacattg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38006096 |
cataaggcctgatgtagttttaaaatttctcaggtaaaatcagtagaaggttatcttaattactaagagacagattatgcattagcatagattgacattg |
38005997 |
T |
|
| Q |
111 |
aaggttcaccaggtctattcagcttcaggcaccaaagcagacatttctggataatggcacggaaagcttggaatacagaccatagatcggcatgctcaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38005996 |
aaggttcaccaggtctattcagcttcaggcaccaaagcagacatttctggataatggcacggaaagcttggaatacagaccatagatcggcatgctcaac |
38005897 |
T |
|
| Q |
211 |
tggccaaaaaccatggaccttgactggttagaaat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38005896 |
tggccaaaaaccatggaccttgactggttagaaat |
38005862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University