View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6358_low_17 (Length: 246)
Name: NF6358_low_17
Description: NF6358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6358_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 235
Target Start/End: Original strand, 33601380 - 33601592
Alignment:
| Q |
19 |
accaccacctctatgatccatcccacatcaatataaataaataaagtatttgacccaccaataattataatttcttttgtcnnnnnnnnnnnnnnnnnnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33601380 |
accaccacctctatgatccatcccacatcaatataaataaataaagtatttgacccaccaataattataatttcttttgt----aaaaaaaaaagaaaaa |
33601475 |
T |
 |
| Q |
119 |
tactataattataatttcttaaatagtaatttaacttactcttgtaatttaacaatgtgcattttttaaggatggaaaattataagatcagactagccga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33601476 |
tactataattataatttcttaaatagtaatttaacttactcttgtaatttaacaatgtgcattttttaaggatggaaaattataagatcagactagccga |
33601575 |
T |
 |
| Q |
219 |
ttatgttaaaatttctt |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33601576 |
ttatgttaaaatttctt |
33601592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University