View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6358_low_22 (Length: 228)
Name: NF6358_low_22
Description: NF6358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6358_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 42042160 - 42041941
Alignment:
| Q |
1 |
tcatcccaaaaaatagctcaaaggatgagggagggtattcaagtatatttacacactcaagaatcttgaaacctaggaaatacttatatcatttatgaat |
100 |
Q |
| |
|
|||||||||||| |||||||| | |||||| ||| |||||||||||||||| |||||||||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
42042160 |
tcatcccaaaaactagctcaatgaatgaggaaggatattcaagtatatttatacactcaagaatctgagaacctagcaaatacttagatcatttatgaat |
42042061 |
T |
|
| Q |
101 |
ccatctctctctgcacttcgtaccaaatctccatcccaatatccaaatgatagagctagcatgataatgatacattatcattatcattatcatcaatgca |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42042060 |
ccatctctct--gcacttcgtaccaaatctccatcccaatatccaaatgatagagctagcatgataatgatacattatcattatcattatcatcaatgca |
42041963 |
T |
|
| Q |
201 |
cgtcttgtctgattgaatttat |
222 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42041962 |
tgtcttgtctgattgaatttat |
42041941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University