View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6359_high_4 (Length: 380)
Name: NF6359_high_4
Description: NF6359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6359_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 114 - 375
Target Start/End: Complemental strand, 34473877 - 34473623
Alignment:
| Q |
114 |
tttgggatatccttgcctttcctatgaatggttttcaattccattaatgtttttggaaagatggttttgttggatgattaatccattttgattacaacag |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34473877 |
tttgggatatccttgccttttctatgaatggttttcaattccattaatgtttttggaaagatggttttgttggatgattaatccattttgattacagcag |
34473778 |
T |
|
| Q |
214 |
aaattgggaggaagtgatttggtgtattaatttgagtctcaatctgcaatatatttaatattctggtatatagttgcaattcaaataatcaattattaca |
313 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34473777 |
aaattgggaggaagtgatttggtgtat-------agttgcaatctgcaatatatttaatattatggtatatagttgcaattcaattaatcaattattaca |
34473685 |
T |
|
| Q |
314 |
gcttatgtttacatgaataatacacatttagtaatgctgatacactcacctttgtctctgct |
375 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34473684 |
gcttatgtttacatgaataatgcacatttagtaatgctgatacactcacctttgtctctgct |
34473623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 19 - 88
Target Start/End: Complemental strand, 34474431 - 34474363
Alignment:
| Q |
19 |
gtattggaggaagaaatccaggaaaaaattatggaaacaaagatgcttggagttgtgaaattgaaagtat |
88 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34474431 |
gtattggaggaagaaatcg-ggaaaaaattatggaaacaaagatgcttggagttgtgaaattgatagtat |
34474363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University