View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6359_high_7 (Length: 250)
Name: NF6359_high_7
Description: NF6359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6359_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 86 - 222
Target Start/End: Original strand, 5787786 - 5787922
Alignment:
| Q |
86 |
tatcaacattatgtgggccaagccaaggtggaatttcagaaaggttaaaactttgattatgttgctcttttttcaataatgggaaattatgaagatcttg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5787786 |
tatcaacattatgtgggccaagccaaggtggaatttcagaaaggttaaaactttgattatgttgctcttttttcaataatgggaaattatgaagatcttg |
5787885 |
T |
 |
| Q |
186 |
ttgaggattattgaattggttttgtagatttatcatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5787886 |
ttgaggattattgaattggttttgtagatttatcatg |
5787922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University