View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6359_low_13 (Length: 238)
Name: NF6359_low_13
Description: NF6359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6359_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 228
Target Start/End: Complemental strand, 30590977 - 30590769
Alignment:
| Q |
20 |
catctttgaactatctatcatatatactatatatttctataactaagttgaaattctttaggtcgttttttggctcaaaattttggggactaaagtccta |
119 |
Q |
| |
|
||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30590977 |
catctctgaattatctatcatgtatactatatatttctataactaagttgaaattctttaggtcgttttttggctcaaaattttggggcctaaagtccta |
30590878 |
T |
 |
| Q |
120 |
gcttggccctcgagcaggccctgaaaactgggacattgttctttccgaacaaggggtcgcgaatccagatacacactaagataattctttttctaatgct |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||| |||| |||||| |
|
|
| T |
30590877 |
gcttggccatcgagcaggccctgaaaactgggacattgttctttccgaacaaggggtcaagaatcaagatacaaactaagataattctgtttcaaatgct |
30590778 |
T |
 |
| Q |
220 |
tcaccgagg |
228 |
Q |
| |
|
||||||||| |
|
|
| T |
30590777 |
tcaccgagg |
30590769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University