View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6359_low_7 (Length: 250)

Name: NF6359_low_7
Description: NF6359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6359_low_7
NF6359_low_7
[»] chr8 (1 HSPs)
chr8 (86-222)||(5787786-5787922)


Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 86 - 222
Target Start/End: Original strand, 5787786 - 5787922
Alignment:
86 tatcaacattatgtgggccaagccaaggtggaatttcagaaaggttaaaactttgattatgttgctcttttttcaataatgggaaattatgaagatcttg 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5787786 tatcaacattatgtgggccaagccaaggtggaatttcagaaaggttaaaactttgattatgttgctcttttttcaataatgggaaattatgaagatcttg 5787885  T
186 ttgaggattattgaattggttttgtagatttatcatg 222  Q
    |||||||||||||||||||||||||||||||||||||    
5787886 ttgaggattattgaattggttttgtagatttatcatg 5787922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University