View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6360_high_16 (Length: 350)
Name: NF6360_high_16
Description: NF6360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6360_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 128 - 258
Target Start/End: Complemental strand, 24742610 - 24742480
Alignment:
| Q |
128 |
ggaaccttaggattgctcatattgctgaagagatggaagaggaagatgcaataaggtaaattgaagagaatgaaaaagaggagaaggtttgtgtatagag |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24742610 |
ggaaccttaggattgctcatattgctgaagagatggaagaggaagatgcaataaggtaaattgaagagaatgaaaaagaggagaaggtttgtgtatagag |
24742511 |
T |
|
| Q |
228 |
aaaggaggaaaatcaaaaggtagggtttttg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24742510 |
aaaggaggaaaatcaaaaggtagggtttttg |
24742480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University