View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6360_high_19 (Length: 332)
Name: NF6360_high_19
Description: NF6360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6360_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 17 - 226
Target Start/End: Original strand, 28088906 - 28089122
Alignment:
| Q |
17 |
aagtggaactttgtaaacgataggactataatggctaacgcaaatatgaccaaaa-gtttaaatgtttttatttcatata--gagacttccaaaacaata |
113 |
Q |
| |
|
|||||| ||||||| ||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
28088906 |
aagtgggactttgttaacaataggactataatggctaacgcaaatatgaccaaaaagttttaatgtttttatttcatatatagagacttcaaaaacaata |
28089005 |
T |
|
| Q |
114 |
cgagtatca---atttgtgaggctaaaatggatgtttatttatttgatttgtggtgttcgtctacgttgaaaatgtggaaatagag-nnnnnnnattgag |
209 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||| |||||| |
|
|
| T |
28089006 |
tgagtatcatcaatttgtgaggctaaaatggatgtttatttatttggtttgtggtgttcttctacgtagaaaatgtggaaatagagttttttttattgag |
28089105 |
T |
|
| Q |
210 |
tagtgtggaaatagaga |
226 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28089106 |
tagtgtggaaatagaga |
28089122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 230 - 316
Target Start/End: Original strand, 28089378 - 28089464
Alignment:
| Q |
230 |
agtttagtgttttgaattcttgtcttacaaatatttcacatggtaggagaacactaaaaatcttcgaagttttatgtaacagatatt |
316 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||||||||||||| |||||||||||||||||| || |||| | ||||||||||| |
|
|
| T |
28089378 |
agtttagtgttttgaatttttgtcttaaaaacatttcacatggtagaagaacactaaaaatcttccaacttttgtctaacagatatt |
28089464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University