View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6360_high_29 (Length: 280)
Name: NF6360_high_29
Description: NF6360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6360_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 6822512 - 6822753
Alignment:
| Q |
1 |
tgcgggttcgtgtctccatctcaccagagggttgagggttgtttaggaaggcggtggtggggctactgtggcattgccttctagctggtggactggggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6822512 |
tgcgggttcgtgtctccatctcaccagagggttgatggttgtttaggaaggcggtcg---ggctactgtggcattgccttctagctggtggactggggtt |
6822608 |
T |
 |
| Q |
101 |
tgagtggtggcttgaaatagcgcagatttaggttgttagagggaattgcttgtttcaagatccgagctctctgttcacggttgttctttaaggtgacctg |
200 |
Q |
| |
|
|||| ||| ||||||||| |||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6822609 |
tgagcggttgcttgaaatggcgctgatttaggttgttagagggaataacttgtttcaagatctgagctctctgttcacggtggttctttaaggtgacctg |
6822708 |
T |
 |
| Q |
201 |
tgttttttaggtggcgtgtgtttggcgccatcaactttttaggtg |
245 |
Q |
| |
|
|| |||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
6822709 |
tgggttttaggtggtatgtgtttggcagcatcaactttttaggtg |
6822753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 204 - 268
Target Start/End: Original strand, 6822744 - 6822808
Alignment:
| Q |
204 |
tttttaggtggcgtgtgtttggcgccatcaactttttaggtgctattgtctgtccggcctatgct |
268 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||| ||||||| ||| |||||||||| |
|
|
| T |
6822744 |
tttttaggtggcatgtgtttggcgccatcatctttttaggtgatattgtccgtctggcctatgct |
6822808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University