View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6360_high_35 (Length: 253)
Name: NF6360_high_35
Description: NF6360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6360_high_35 |
 | |
|
| [»] scaffold0047 (1 HSPs) |
| | |
|
| [»] scaffold0005 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 39070826 - 39070984
Alignment:
| Q |
1 |
ctttgaagagagatatttgaagggatagacaaaactcacttcttaagcaccccttcaaatcttcctcactttatgaatatgagcaatcattgttttgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39070826 |
ctttgaagagagatatttgaagggatagacaaaactcacttcttaagcaccccttcaaatcttcctcactttatgaatatgagcaatcattgttttgctt |
39070925 |
T |
|
| Q |
101 |
cctaacacgaagaaatttaataagtctattagtagatcaagaaaaatgctcaactcacc |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39070926 |
cctaacacgaagaaatttaataagtctattagtagatcaagaaaaatactcaactcacc |
39070984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 43505119 - 43505273
Alignment:
| Q |
1 |
ctttgaagagagatatttgaagggatagacaaaactcacttcttaagcaccccttcaaatcttcctcactttatgaatatgagcaatcattgttttgctt |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
43505119 |
ctttgaagagagatattttaagggatagacaaaactcacctcttaagcaccccttcaaatcttccttactttatgaatatgagcaatcgttgttttgctt |
43505218 |
T |
|
| Q |
101 |
cctaacacgaagaaatttaataagtctattagtagatcaagaaaaatgctcaact |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43505219 |
cctaacacgaagaaatttaataagtctattagtagatcaagaaaaatgctcaact |
43505273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 215 - 245
Target Start/End: Original strand, 39071040 - 39071070
Alignment:
| Q |
215 |
gttttatcacacaaaatggtaggagtataat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39071040 |
gttttatcacacaaaatggtaggagtataat |
39071070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 9 - 108
Target Start/End: Complemental strand, 348839 - 348740
Alignment:
| Q |
9 |
agagatatttgaagggatagacaaaactcacttcttaagcaccccttcaaatcttcctcactttatgaatatgagcaatcattgttttgcttcctaacac |
108 |
Q |
| |
|
|||||||||| |||||||||||||||||| | ||| | | ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
348839 |
agagatattttaagggatagacaaaactcgccccttttgtagtccttcaaatcttcctcactttatgaatatgagcaaccattgttttgctttctaacac |
348740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 85 - 120
Target Start/End: Original strand, 25124 - 25159
Alignment:
| Q |
85 |
aatcattgttttgcttcctaacacgaagaaatttaa |
120 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25124 |
aatcattgttttacttcctaacacgaagaaatttaa |
25159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 85 - 120
Target Start/End: Complemental strand, 11396 - 11361
Alignment:
| Q |
85 |
aatcattgttttgcttcctaacacgaagaaatttaa |
120 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11396 |
aatcattgttttacttcctaacacgaagaaatttaa |
11361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 85 - 120
Target Start/End: Original strand, 14828313 - 14828348
Alignment:
| Q |
85 |
aatcattgttttgcttcctaacacgaagaaatttaa |
120 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14828313 |
aatcattgttttacttcctaacacgaagaaatttaa |
14828348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University