View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6360_low_35 (Length: 265)
Name: NF6360_low_35
Description: NF6360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6360_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 4 - 255
Target Start/End: Complemental strand, 36415394 - 36415145
Alignment:
| Q |
4 |
ttaggcacttgtttttgcattgcgatgctgttattttcatatggaatggatcatttttccctcctacactaaaacaactttctactattggattggttta |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36415394 |
ttaggcacttgtttttgcattgcgatgctgttattttcatatggaatggatcatttttccctcctacactaaaacaactttctactattgg-----ttta |
36415300 |
T |
|
| Q |
104 |
acattctagtaataataa---agaggcagaaaatgtgtgcaaatgtttagagtatctcttttccccttcaaaataattaggataggtaggattgtgttac |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36415299 |
acattctagtaataataataaagaggcagaaaatgtgtgcaaatgtttagagtattttttttccccttcaaaataataaggataggtaggattgtgttac |
36415200 |
T |
|
| Q |
201 |
ggactctcgctgatgttctttacatttatctttgttttcatccttatgtcctttg |
255 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36415199 |
ggactattgctgatgttctttacatttatctttgttttcatccttatgtcctttg |
36415145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University