View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6362_low_4 (Length: 381)
Name: NF6362_low_4
Description: NF6362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6362_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 6e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 44159755 - 44159970
Alignment:
| Q |
16 |
caatagaaagcttatacaccaccaaacaaaccccaacgataatagaaagttttaaacttcaaaatacatccaaataaacccaaacaaatggaaaacaaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44159755 |
caatagaaagcttatacaccaccaaacaaaccccaacgataatagaaagttttaaacttcaaaatacatccaaataaacccaaacaaatgg--------- |
44159845 |
T |
|
| Q |
116 |
acatggaaatcaattccttcttctgaatattatatgtcattggctatttacgggccatgccattttcaactgttggagcctccatctccatcacccctct |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44159846 |
------aaatcaattccttcttatgaatattatatgtcattggctatttacgggccatgccattttcaattgttggagcctccatctccatcacccctct |
44159939 |
T |
|
| Q |
216 |
ggttttcactctcacgttctctttccaacct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44159940 |
ggttttcactctcacgttctctttccaacct |
44159970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University