View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6362_low_5 (Length: 353)
Name: NF6362_low_5
Description: NF6362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6362_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 8 - 336
Target Start/End: Complemental strand, 7117456 - 7117140
Alignment:
| Q |
8 |
attatactcttgaaacaaattaaccaggaaacac--gttgatttgcatacatcaaacaaacttcgtaaatagcaacatgagtgagtgagaactccaaaaa |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7117456 |
attacactcttgaaacaaattaaccaggaaacacacgttgatttgcatacatcaaacaaacttcgtaaatagcaacatgagtgagtgagaactccaaaaa |
7117357 |
T |
 |
| Q |
106 |
cgaacaccgctattggttcaacactagtcataatactacattatatattgatgtgacataaatatatacaaggtttagtgcttagttagatttatatgat |
205 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7117356 |
cgaacaccgcttttggttcaacactagtcatactactacattatatt--------------atatatacaaggtttagtgcttagttagatttatatgat |
7117271 |
T |
 |
| Q |
206 |
caatcactaacttcatctatagggttcaattttgacgatccgaaactggcaacatgaaactgagcagcatacttgctggatgcagcttccattactggtg |
305 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7117270 |
caatcactaacttcatctacagggttcaattttgacgatccgaaactggcaacatgaaactgagctgcatacttgctggatgcagcttccattactggtg |
7117171 |
T |
 |
| Q |
306 |
gctcattcagaaatgcccagttactcttagt |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7117170 |
gctcattcagaaatgcccagttactcttagt |
7117140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University