View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6363_high_14 (Length: 304)
Name: NF6363_high_14
Description: NF6363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6363_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 171 - 286
Target Start/End: Original strand, 41116828 - 41116943
Alignment:
| Q |
171 |
tgaggctacaatagagacccataataataattgatgggtgcatcttttgcttttgtttttggtcatttaggcttataaggaaaagacaaaaaagcaaggc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41116828 |
tgaggctacaatagagacccataataataattgatgggtgcatcttttgcttttgtttttggtcatttaggcttataaggaaaagacaaaaaaacaaggc |
41116927 |
T |
 |
| Q |
271 |
tttgattggtagcaaa |
286 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41116928 |
tttgattggtagcaaa |
41116943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 8 - 104
Target Start/End: Original strand, 41116665 - 41116761
Alignment:
| Q |
8 |
tgtcgaagaatatatgttaccatgaggttccatcttttcccccaaaaatcacccaatgaagatgacaaataaggctcattagaaggtaattcaagct |
104 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41116665 |
tgtcgcagaatatatgttaccatgaggttccatcttttcccccaaaaatcacccaatgaagatgacaaataaggctcattagaaggtaattcaagct |
41116761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University