View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6363_high_21 (Length: 276)
Name: NF6363_high_21
Description: NF6363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6363_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 41832499 - 41832237
Alignment:
| Q |
1 |
tacttaagtaatgtggtaagaatagtttactcaattgtcttgtttcatgcagtaatgttcatgtactatttatatgaatgacaatgagctcatgtttgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41832499 |
tacttaagtaatgtggtaagaatagtttactcaattgtcttgtttcatgcagtaatgttcatgtactatttatatgaatgacaatgagctcatgtttgca |
41832400 |
T |
|
| Q |
101 |
cacaaaaatgtcaaaaccggtcaacttatatgctacaccttcatgaagtcgtgccactttattgttgtgctttttgttgctctatttcattgcattgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41832399 |
cacaaaaatgtcaaaaccggtcaacttatatgctacaccttcatgaagtcgtgccactttattgttgtgctttttgttgctctatttcattgcattgctt |
41832300 |
T |
|
| Q |
201 |
aatacaactgcagtatttgagcagtatggctatgactgagatgagataacactgccacaggtt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41832299 |
aatacaactgcagtatttgagcagtatggctatgactgagatgagataacactgccacaggtt |
41832237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 143 - 240
Target Start/End: Complemental strand, 7097828 - 7097732
Alignment:
| Q |
143 |
atgaagtcgtgccactttattgttgtgctttttgttgctctatttcattgcattgcttaatacaactgcagtatttgagcagtatggctatgactgag |
240 |
Q |
| |
|
|||||||| ||| | ||||||||| |||||||| || ||| ||||||| ||||||| ||||||||||||| ||||| || |||||||||| ||||| |
|
|
| T |
7097828 |
atgaagtcttgcaattttattgttatgctttttctttttct-tttcattacattgctcaatacaactgcagaatttgggcgatatggctatggctgag |
7097732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University