View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6363_high_22 (Length: 266)

Name: NF6363_high_22
Description: NF6363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6363_high_22
NF6363_high_22
[»] chr4 (1 HSPs)
chr4 (19-79)||(22054918-22054978)


Alignment Details
Target: chr4 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 22054978 - 22054918
Alignment:
19 actgtatccttagaaggctaattcaattacctacaactagtatgttcaacccgaagtctaa 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
22054978 actgtatccttagaaggctaattcaattacctacaactagtatgttcagcccgaagtctaa 22054918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University