View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6363_high_38 (Length: 201)
Name: NF6363_high_38
Description: NF6363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6363_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 46 - 179
Target Start/End: Complemental strand, 49886673 - 49886540
Alignment:
| Q |
46 |
ttacttacaggtttatcaaatcaacaatgagattcggactcttacgaatactagtatgagttgaattcttgcaaattcaaccaaccttcacattgtatga |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49886673 |
ttacttacaggtttatcaaatcaacaatgagattcggactcttacgaatactagtatgagttgaattcttgcaaattcaaccaaccttcacattgtatga |
49886574 |
T |
 |
| Q |
146 |
agtaagttgaatctttagaaattaatattataga |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
49886573 |
agtaagttgaatctttagaaattaatattataga |
49886540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University