View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6363_low_12 (Length: 335)
Name: NF6363_low_12
Description: NF6363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6363_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 237
Target Start/End: Complemental strand, 13464317 - 13464089
Alignment:
| Q |
9 |
gagaagaagcaggatgaaaaaggtgtggaagtggtcatgtgtttttggtgagtgtttcgagttatacacaatgttattgcatttgtcatattgcttttat |
108 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13464317 |
gagaagaagcaggataaaaaaggcgtggaagtggtcctgtgtttttggtgagtgtttcgagttatacacaatgttattgcatttctcatattgcttttat |
13464218 |
T |
 |
| Q |
109 |
tcacatgcttttaagttgttgtttaatgggtcttggtagggtaatgttaagattccagactttagagtaaatggcatgtggggtaggtttggtctggaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13464217 |
tcacatgcttttaagttgttgtttaatgggtcttggtagggtaatgttaagattccagactttagagtaaatggcatgtggggtaggtttggtctggaaa |
13464118 |
T |
 |
| Q |
209 |
agttgcaacttttttggagttattctttg |
237 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
13464117 |
agttgcaaattttttggagttattctttg |
13464089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 270 - 317
Target Start/End: Complemental strand, 13464076 - 13464029
Alignment:
| Q |
270 |
cataacatatacatattgtgtgtatctattgtgtatagtgcatgtatt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13464076 |
cataacatatacatattgtgtgtatctattgtgtatagtgcatgtatt |
13464029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University