View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6363_low_2 (Length: 594)
Name: NF6363_low_2
Description: NF6363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6363_low_2 |
 |  |
|
| [»] scaffold0014 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0014 (Bit Score: 62; Significance: 2e-26; HSPs: 2)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 84 - 153
Target Start/End: Original strand, 33003 - 33072
Alignment:
| Q |
84 |
ttccttacacataattaaagttgacattgggttgtttgggcctattaggaattaaggtatggagatttca |
153 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33003 |
ttccttacacagaactaaagttgacattgggttgtttgggcctattaggaattaaggtatggagatttca |
33072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 527 - 574
Target Start/End: Original strand, 33068 - 33115
Alignment:
| Q |
527 |
tttcaattgcctaatatatcatagcctacaattaattaattcctcctc |
574 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33068 |
tttcaattgcctaatatatcatagcctacaattaattaattcctcctc |
33115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 3e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 28 - 91
Target Start/End: Original strand, 770180 - 770243
Alignment:
| Q |
28 |
tataagcaactgtacgtgcgtattgtactgagaactaatgaaactttgtgcgttacttccttac |
91 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
770180 |
tataagcaactgtatgtgcgtattgtactgagaactaatgaaactttgtgcgttacttccttac |
770243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University