View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6363_low_23 (Length: 266)
Name: NF6363_low_23
Description: NF6363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6363_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 22054978 - 22054918
Alignment:
| Q |
19 |
actgtatccttagaaggctaattcaattacctacaactagtatgttcaacccgaagtctaa |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22054978 |
actgtatccttagaaggctaattcaattacctacaactagtatgttcagcccgaagtctaa |
22054918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University