View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6363_low_24 (Length: 266)
Name: NF6363_low_24
Description: NF6363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6363_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 4e-44; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 62 - 173
Target Start/End: Complemental strand, 52443870 - 52443757
Alignment:
| Q |
62 |
cttagattagatttttcaatattgtgaggagatgaca--attataatttagaataaactagtaaacgagtttttaattttacatgaaactaaaataatta |
159 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52443870 |
cttagattagatttttcaattatgtgaggagatgacacaattataatttagaataaactactaaacgagtttttaattttacatgaaactaaaataatta |
52443771 |
T |
|
| Q |
160 |
aatatattaactcc |
173 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52443770 |
aatatattaactcc |
52443757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 42
Target Start/End: Complemental strand, 52443921 - 52443882
Alignment:
| Q |
3 |
aaattaattaatttatgcacatttaatgttacggtataat |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52443921 |
aaattaattaatttatgcacatttaatgttacagtataat |
52443882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 219 - 259
Target Start/End: Complemental strand, 52443648 - 52443608
Alignment:
| Q |
219 |
caatatgtacaattatttatgcgcaaactttgatgatgatg |
259 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
52443648 |
caatatctacaattagttatgcgcaaactttgatgatgatg |
52443608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University