View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6363_low_29 (Length: 239)
Name: NF6363_low_29
Description: NF6363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6363_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 10068679 - 10068495
Alignment:
| Q |
1 |
ttatcttcctgtttatgtagtttttaaaaaggcttaattcaatttctcattcaaaatctaatcatgaacatgtagaaattgaaatgg-aatgggcatggg |
99 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
10068679 |
ttatcttcttgtttatgtagtttttaaaaaggct-aatccaatttctcattcaaaatctaatcatgaacatgtagaaattgaaatgggaataggcatggg |
10068581 |
T |
|
| Q |
100 |
aaagtagaaggattatttcatcaaaatgggaagattgaatataggattcagaacttgtgcattatgagatgggaaagaagtatctc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10068580 |
aaagtagaaggattatttcatcaaaatgggaagattgaatataggattcagaacttgtgcattatgagatgggaaagaagtatctc |
10068495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 63
Target Start/End: Complemental strand, 10075306 - 10075272
Alignment:
| Q |
29 |
aaggcttaattcaatttctcattcaaaatctaatc |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
10075306 |
aaggcttaattcaatttctcattccaaatctaatc |
10075272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University