View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6365_high_23 (Length: 365)
Name: NF6365_high_23
Description: NF6365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6365_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 51 - 172
Target Start/End: Original strand, 6461733 - 6461854
Alignment:
| Q |
51 |
attcattatcaagtatgtaggggtggttatatttagacacgcttagattcttaacctttcatgcgagaaaaatagagtaactttagacaacatttgcata |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6461733 |
attcattatcaagtatgtaggggtggttatatttagacacgcttagattcttaacctttcatgcgagaaaaatagagtaactttagacaacatttgcata |
6461832 |
T |
 |
| Q |
151 |
aaacatgagagatagtgatgtt |
172 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6461833 |
aaacatgagagatagtgatgtt |
6461854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University