View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6365_high_38 (Length: 253)
Name: NF6365_high_38
Description: NF6365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6365_high_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 6058516 - 6058275
Alignment:
| Q |
1 |
tagatgatagtttctacaaaaacggagattcttcttcttcggtaacaccatttcctttgcttgaatttcttgaatttgaaaacatgccttgttggaaggt |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6058516 |
tagatggtagtttctacaaaaacggagattcttcttcttccgtaacaccatttcctttgcttgaatttcttgaatttgaaaacatgccttgttggaaggt |
6058417 |
T |
|
| Q |
101 |
gtggcattcatctgagtcatgtgcttttcctcaacttaagcgtctcacaatagaaaattgtccaaaattaagaggagatttaccacttcacctcccttca |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6058416 |
gtggcattcatctgagtcatatgcttttcctcaacttaagcgtctcacaatagaaaattgtccaaaattaagaggagatttaccagttcacctcccttca |
6058317 |
T |
|
| Q |
201 |
ttgaaaacacttgcaattagaagttgtgagcatcttgtctct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6058316 |
ttgaaaacacttgcaattagaagttgtgagcatcttgtctct |
6058275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University