View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6365_low_31 (Length: 301)
Name: NF6365_low_31
Description: NF6365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6365_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 290
Target Start/End: Original strand, 11639063 - 11639336
Alignment:
| Q |
18 |
gatcaacgagggggttaatgatattaaatttgattacatgattttgtttttcttttcggtaggagatggatgaatgaaggtgaaagacttgacatatctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11639063 |
gatcaacgagggggttaatgatattaaatttgattacatgattttgtttttcttttcggtaggagatggatgaatgaaagtgaaagacttgacatatctt |
11639162 |
T |
|
| Q |
118 |
gttttagannnnnnnnaactaaacaaattgtccagtttagatgcttttgctcttaatttatatagtttatgactaatgttactgt-nnnnnnntattatg |
216 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
11639163 |
gttttagattttttttaactaaacaaattgttcaatttagatgcttttgctcttaatttatatagtttatgactaatggtactgtaaaaaaaaaattatg |
11639262 |
T |
|
| Q |
217 |
ttcatacatgtaaccgtgataatgtccaatgtctttgacattagcagtatcaacgtgttgtgttcgatgtctgt |
290 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11639263 |
ttcatacatgtaaccgtgataatgtcctatgtttttgacattagcagtgtcaacgtgttgtgttcgatgtctgt |
11639336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University