View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6365_low_44 (Length: 240)
Name: NF6365_low_44
Description: NF6365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6365_low_44 |
 | |
|
| [»] scaffold0096 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 7896036 - 7896247
Alignment:
| Q |
14 |
atgaattatgggactagctgagaatatggcctcgcccgcaagaatatgagctgtcacattcgcttctcgccgactaaactctacccttgagtttgcaaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7896036 |
atgaattatgggactagctgagaatatggcctcgtccgcaagaatatgagctgtcacattcgcttctcgccgactaaactctacccttgagtttgcaaaa |
7896135 |
T |
|
| Q |
114 |
tgtgag---aacaggttccgacatgccgtaattatgtaccaaactccattacatcgtttcgtggtgaattgaaagcttctgctgttactttggaatcggt |
210 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7896136 |
tgtgagaacaacaggttccgacatgccgtaattatgtaccaaactccgttacgtcgtttcgtggtgaattgaaagcttctgctgttactttggaatcggt |
7896235 |
T |
|
| Q |
211 |
cacaaagtccac |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7896236 |
cacaaagtccac |
7896247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 14 - 113
Target Start/End: Complemental strand, 21098133 - 21098034
Alignment:
| Q |
14 |
atgaattatgggactagctgagaatatggcctcgcccgcaagaatatgagctgtcacattcgcttctcgccgactaaactctacccttgagtttgcaaaa |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||| ||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21098133 |
atgaattatgggactagttgagaatatggcatcgctcgcaagaatatgaactgccacattcgcttgtcgccgactaaactctacccttgagtttgcaaaa |
21098034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 59 - 108
Target Start/End: Original strand, 46884780 - 46884829
Alignment:
| Q |
59 |
atgagctgtcacattcgcttctcgccgactaaactctacccttgagtttg |
108 |
Q |
| |
|
||||||| ||||||| |||| ||||||| ||||||||||||| ||||||| |
|
|
| T |
46884780 |
atgagctatcacattggcttgtcgccgattaaactctaccctggagtttg |
46884829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 28 - 113
Target Start/End: Original strand, 43033 - 43118
Alignment:
| Q |
28 |
tagctgagaatatggcctcgcccgcaagaatatgagctgtcacattcgcttctcgccgactaaactctacccttgagtttgcaaaa |
113 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
43033 |
tagctgagaatatggcctcgcccacaagaatatgagttgtcacattcgcttgtcgccgactaaactctacctttgagtttgcaaaa |
43118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University