View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6365_low_45 (Length: 212)
Name: NF6365_low_45
Description: NF6365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6365_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 5375097 - 5374901
Alignment:
| Q |
18 |
cagccttcatgtgtaaatgaagaaggagaaacttcacttgttgaggataagtgttcgtgaagttggggaagagacagagaggattaggattgactgttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5375097 |
cagccttcatgtgtaaatgaagaaggagaaacttcacttgttgaggataagtgttcgtgaagttggggaagagacagagaggattaggattgactgttat |
5374998 |
T |
 |
| Q |
118 |
a----------gttgtaaatgaagatggaattattgcacttgttatacactttgtttgataggtatcctcaaattggaatgcttgtctgtgatgcta |
204 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
5374997 |
agtcaggagtggttgtaaatgaagatggaattattgcacttgttatacactttgtttgataggtatcctcaaattggaatgcttgactgtgttgcta |
5374901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 64
Target Start/End: Original strand, 17298754 - 17298790
Alignment:
| Q |
28 |
gtgtaaatgaagaaggagaaacttcacttgttgagga |
64 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| |
|
|
| T |
17298754 |
gtgtaaatgaagaaggagcaatttcacttgttgagga |
17298790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University