View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6366_high_13 (Length: 206)
Name: NF6366_high_13
Description: NF6366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6366_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 13 - 190
Target Start/End: Complemental strand, 53983099 - 53982923
Alignment:
| Q |
13 |
gagagatgaatccgaatttcatgacattgatggagttcttacaaatccaaatttcatnnnnnnnnnnnnnnnnntgatgattcaagtgtgaaaatcatca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53983099 |
gagagatgaatccgaatttcatgacattgatggagttcttacaaatccaaatttcataaaaacaaaaaaaaaa-tgatgattcaagtgtgaaaatcatca |
53983001 |
T |
 |
| Q |
113 |
ctaaatttattataattcacaaaattaacaagaatagttgcagatcataataagtgatgaatttgtaagaacaattat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53983000 |
ctaaatttattataattcacaaaattaacaagaatagttgcagatcataataagtgatgaatttgtaagaacaattat |
53982923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University