View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6366_low_13 (Length: 222)
Name: NF6366_low_13
Description: NF6366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6366_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 2714996 - 2715182
Alignment:
| Q |
17 |
aaaatgcatgagattcaaagtcactacaaaattcattttcaccatattacattatgtttctatgaaccattccatgatatctagctacttgtgttgatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2714996 |
aaaatgcatgagattcaaagtcactataaaattcattttcaccatattacattatgtttctatgaaccattccatgatatctagctacttgtgttgatgt |
2715095 |
T |
|
| Q |
117 |
ccttctctaccttccttgtttttgttccgcatgtcttctacaacatgacttgatgccatattatttgagggtcccccaagccccagg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2715096 |
ccttctctaccttccttgtttttgttccgcatgtcttctacaacatgacttgatgccatattatttgagggtcccccaagccccagg |
2715182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University