View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6366_low_14 (Length: 206)

Name: NF6366_low_14
Description: NF6366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6366_low_14
NF6366_low_14
[»] chr4 (1 HSPs)
chr4 (13-190)||(53982923-53983099)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 13 - 190
Target Start/End: Complemental strand, 53983099 - 53982923
Alignment:
13 gagagatgaatccgaatttcatgacattgatggagttcttacaaatccaaatttcatnnnnnnnnnnnnnnnnntgatgattcaagtgtgaaaatcatca 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||                 ||||||||||||||||||||||||||    
53983099 gagagatgaatccgaatttcatgacattgatggagttcttacaaatccaaatttcataaaaacaaaaaaaaaa-tgatgattcaagtgtgaaaatcatca 53983001  T
113 ctaaatttattataattcacaaaattaacaagaatagttgcagatcataataagtgatgaatttgtaagaacaattat 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53983000 ctaaatttattataattcacaaaattaacaagaatagttgcagatcataataagtgatgaatttgtaagaacaattat 53982923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University