View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6366_low_8 (Length: 238)
Name: NF6366_low_8
Description: NF6366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6366_low_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 57 - 238
Target Start/End: Complemental strand, 27145821 - 27145640
Alignment:
| Q |
57 |
aaatgtaaatttagtgttgtttgagtttggtaaaagacctcttatgcagagaaatcatcacaaagtagtgcaggtaggaaactttgggataaaacaatgc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27145821 |
aaatgtaaatttagtgttgtttgagtttggtaaaagacctcttatgctgagaaatcatcacaaagtagtgcaggtaggaaactttgggataaaacaatgc |
27145722 |
T |
 |
| Q |
157 |
acaccatcatattttcatcttgatcaaccaaaaatttgagctgaaatattttatatattattattggatatgtatttagtgg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27145721 |
acaccatcatattttcatcttgatcaaccaaaaatttgagctgaaatattttatatattattattggatatgtatttagtgg |
27145640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University