View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6367_low_6 (Length: 236)
Name: NF6367_low_6
Description: NF6367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6367_low_6 |
 |  |
|
| [»] scaffold0277 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 85 - 222
Target Start/End: Original strand, 17990044 - 17990181
Alignment:
| Q |
85 |
gatcaaacaaatgtgtatgtactgaccgcacattgaaaagggaacaatcaaaatatttagaaaaagtatatttattgccattgacaaacaaattgactct |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17990044 |
gatcaaacaaatgtgtatgtactgaccgcacattgaaaagggaacaaccaaaatatttagaaaaagtatatttattgcctttgacaaacaaattgactct |
17990143 |
T |
 |
| Q |
185 |
tagactaaattgattatccccaacaataataatgatag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17990144 |
tagactaaattgattatccccaacaataataatgatag |
17990181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 17989921 - 17990014
Alignment:
| Q |
1 |
tggaattccgagaactctccaaattaagctccacacggatccattcattttttaacggtgctttttcagacaccagattccattgatcaaacaa |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17989921 |
tggaattccgagaactctccaaattaagctccacacggatccattcattttttaacggtgctttttcagacaccagattccattgatcaaacaa |
17990014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0277 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0277
Description:
Target: scaffold0277; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 67
Target Start/End: Original strand, 1515 - 1561
Alignment:
| Q |
21 |
aaattaagctccacacggatccattcattttttaacggtgctttttc |
67 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
1515 |
aaattaagttccacatggatccattcattttttaaaagtgctttttc |
1561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University