View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6367_low_7 (Length: 219)
Name: NF6367_low_7
Description: NF6367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6367_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 4764905 - 4764708
Alignment:
| Q |
17 |
cataggagaacataagagagataataacaccttttgttcttgtaatgaaaatgtatatgatgcca--------------ggatcacgggatcataacatg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4764905 |
cataggagaacataagagagataataacaccttttgttcttgtaatgaaa-tgtatatgatgccaattggaaaagaaagggatcacgggatcataacatg |
4764807 |
T |
|
| Q |
103 |
atccgaggnnnnnnngaaagtggaagcaccttttatctctatgaagtggaaacaaaaaacgttaagaggagcagatatctcaccaaaccacagcagaat |
201 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4764806 |
atccgaggaagaaaagaaagtggaagcaccttttatctctatgaagtggaaacaaaaaacgttaagaggagcagatatctcaccaaaccacaacagaat |
4764708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University