View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6368_low_10 (Length: 237)
Name: NF6368_low_10
Description: NF6368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6368_low_10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 12226099 - 12225881
Alignment:
| Q |
18 |
cttgtgtggagaacgttttctcaattttgcagcagtttgacagtcaccaaaagcaagtttttggagtcaccctatgaagtatctggaaacatagaaacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
12226099 |
cttgtgtggagaacgttttctcaattttgcagcagtttgacagtcaccaaaagcaagtttttggagtcaccctatggagtatctggaaatatagaaacaa |
12226000 |
T |
 |
| Q |
118 |
taaagtttgaaacgatgtgcaagaattagttcaagacatttgtgaccgtgctggaacattactcacaagctggcagaacgcgcaggttattcgacatgtc |
217 |
Q |
| |
|
|| |||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12225999 |
tagagtttggaacgatgcgcaagaattagttcaagacatttgtgaccgtgctggaacattactcacaagctggcagaacgcgcaggttattcgacatgtc |
12225900 |
T |
 |
| Q |
218 |
caaccaaatacttcagcaa |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12225899 |
caaccaaatacttcagcaa |
12225881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 22 - 237
Target Start/End: Complemental strand, 42927422 - 42927207
Alignment:
| Q |
22 |
tgtggagaacgttttctcaattttgcagcagtttgacagtcaccaaaagcaagtttttggagtcaccctatgaagtatctggaaacatagaaacaataaa |
121 |
Q |
| |
|
||||||||| ||||||| | || |||||||||| || | |||||||||||||| ||||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
42927422 |
tgtggagaatgttttctgagttctgcagcagttcgataaccaccaaaagcaagtgtttggagtcaccctatggagcatttggaaacatagaaacaataaa |
42927323 |
T |
 |
| Q |
122 |
gtttgaaacgatgtgcaagaattagttcaagacatttgtgaccgtgctggaacattactcacaagctggcagaacgcgcaggttattcgacatgtccaac |
221 |
Q |
| |
|
||||| || |||||||| |||| | ||||||||||||||| || |||||| |||| ||||| || ||| |||| |||||| || |||| ||||||||| |
|
|
| T |
42927322 |
gtttggaatgatgtgcaggaatcaactcaagacatttgtgatcgagctggatcattgctcaccagttggaagaatgcgcagattgttcggcatgtccaag |
42927223 |
T |
 |
| Q |
222 |
caaatacttcagcaac |
237 |
Q |
| |
|
||||| || ||||||| |
|
|
| T |
42927222 |
caaattctgcagcaac |
42927207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University