View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6368_low_11 (Length: 224)
Name: NF6368_low_11
Description: NF6368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6368_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 23285556 - 23285763
Alignment:
| Q |
1 |
ttttttaaaataaaaaacaatcatgcataatgcaaaaacttatttctactattgatcaatatgtcnnnnnnnnn-agcaaattgatcaatatgtcttatt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23285556 |
ttttttaaaataaaaaacaatcatgcataatgcaaaaacttatttctactattgatcaatatgtctttttttttgagcaaattgatcaatatgtcttatt |
23285655 |
T |
|
| Q |
100 |
gttagattaaatgtgacttattaatctaattgtgaaggacaaatttgtgctagtgcaagacttaattccgtgttcaaattagagaaagcatatattgagg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23285656 |
gttagattaaatgtgacttattaatctaattgtgaaggacaaatttgtgctagtgcaagacttaattccgtgttcacattagagaaagcatatattgagg |
23285755 |
T |
|
| Q |
200 |
cttattcc |
207 |
Q |
| |
|
|||||||| |
|
|
| T |
23285756 |
cttattcc |
23285763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University