View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6370_low_1 (Length: 420)
Name: NF6370_low_1
Description: NF6370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6370_low_1 |
 | |
|
| [»] scaffold0032 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0032 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 34 - 403
Target Start/End: Complemental strand, 35846 - 35490
Alignment:
| Q |
34 |
attcgattttagcgttgaaggtggggtgtgtcattaggtaagatacgccaatcatattagagaagaggtggagacgtattttacaaaccatgtctcggtt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35846 |
attcgattttagcgttgaaggtggggtgtgtcattaggtaagatacgccaatcatattagagaagaggtggagacgtattttacaaaccatgtctcggtt |
35747 |
T |
|
| Q |
134 |
actcagtcggaacatcctaaattatatggattggatttttcattactattagaagaagaggattgaattttgattgcctcattttcaccaaaagaaactg |
233 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35746 |
actcattcggaacatcctaaattatatggattggatttttcgttactattagaagaagaggattgaattttgattgcctcattttcaccaaaagaaactg |
35647 |
T |
|
| Q |
234 |
agaggtggtggttttgagtgatgtaaataaaatatcgggtccgtatgattttaactttgttttatttaggctttttaactaatgtttgatcaatttcata |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
35646 |
agaggtggtggttttgagtgatgtaaataaaatatcgggtccgtatgattttaactttattttattaaggctttttgactaatgtttgatcaat------ |
35553 |
T |
|
| Q |
334 |
ggattgcaagactcccaagagccaagagcctggtgtcttacttttacgtattcctggagtgatcgtgcct |
403 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35552 |
ggattgcaagactc-------ccaagagcctggtgtcttacttttacgtattcccagagtgatcgtgcct |
35490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University