View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6370_low_4 (Length: 274)
Name: NF6370_low_4
Description: NF6370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6370_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 36863658 - 36863396
Alignment:
| Q |
1 |
aacttaatcaattgaatcttgta--caatgagtatgagtactacattttgttttatactatcaattgatgacaatcaaatttatgtctaacttgtttagg |
98 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36863658 |
aacttaaacaattgaatcttgtatacaatgagtatgagtactacattttgttttatactatcaattgatgacaatcaaatttatgtcta---------gg |
36863568 |
T |
 |
| Q |
99 |
tagctacaagctatattatagtcaaacattttt-atgatttgataatttatgattgatggcaatgtaaattttttataccaaattaccaatacataattc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36863567 |
tagctacaagctatattatagtcaaacattttttatgatttgataatttatgattgatggcaatgtaaattttttataccaaattaccaatacataatac |
36863468 |
T |
 |
| Q |
198 |
atatcaactaattaagtttaaaactatattacctttccatcgtattctttacgggcaaaaatctctgctgct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36863467 |
atatcaactaattaagtttaaaactatattacctttccatcgtattctttacgggcaaaaatctctggtgct |
36863396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University