View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6370_low_7 (Length: 243)
Name: NF6370_low_7
Description: NF6370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6370_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 24799797 - 24800008
Alignment:
| Q |
18 |
gtaaggacaagcaatatcgattggccacatgacattctgaacatgttttctgcttcagaagtacttaactatcattttcaannnnnnnnnnnnnnnatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24799797 |
gtaaggacaagcaatatcgattggccacatgacattctgaacatgttttctgcttcagaagtacttaactatcattttca-tttatttatttatttatgt |
24799895 |
T |
|
| Q |
118 |
gtagacaagtttttgaaggaatctagtttagttcgtgtgaaactgtcagaaaatgtgtcttcaatgtggtgttagagatgtattcatcaattcaattggc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24799896 |
gtagacaagtttttgaaggaatctagtttagttcgtgtgaaactgtcagaaaatgtgtcttcaatgtggtgttagagatgcattcatcaattcaattggc |
24799995 |
T |
|
| Q |
218 |
tccttagtattat |
230 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
24799996 |
tccttaatattat |
24800008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University